SJ. Rocks @SaraJaneRocks
04 October, 08:11

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396
memes matter @NoComment
04 October, 08:53
In response SJ. Rocks to her Publication

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396
The Mac @TheMac
04 October, 08:59
In response memes matter to her Publication
EGFP Sequence (717bp without STOP CODON):
5'-
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAA GTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGC TGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAG CAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTA CAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG ACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAAC GGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACAC CCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACG AGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG +STOP CODON-3'

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396
memes matter @NoComment
04 October, 09:02
In response The Mac to his Publication
What is the GFP nucleotide sequence?

Green fluorescent protein.

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396
The Mac @TheMac
04 October, 09:09
In response memes matter to her Publication
👍🏻

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396
The Mac @TheMac
04 October, 09:18
In response The Mac to his Publication

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396
The Mac @TheMac
04 October, 09:21
In response The Mac to his Publication
Inhibitors of cathepsin L prevent severe acute respiratory syndrome coronavirus entry
Graham Simmons*†, Dhaval N. Gosalia‡, Andrew J. Rennekamp*, Jacqueline D. Reeves*, Scott L. Diamond‡§, and Paul Bates*†
*Department of Microbiology, School of Medicine and Departments of ‡Bioengineering and §Chemical and Biomolecular Engineering, Institute for Medicine and Engineering, University of Pennsylvania, Philadelphia, PA 19104
Communicated by Harold E. Varmus, Memorial Sloan–Kettering Cancer Center, New York, NY, July 1, 2005 (received for review May 5, 2005)

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396
Only people mentioned by TheMac in this post can reply
The Mac @TheMac
04 October, 09:37
In response The Mac to his Publication

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396
The Mac @TheMac
04 October, 09:52
In response The Mac to his Publication
Trypsin (EC 3.4.21.4) is a serine protease from the PA clan superfamily, found in the digestive system of many vertebrates, where it hydrolyzes proteins.[2][3] Trypsin is formed in the small intestine when its proenzyme form, the trypsinogen produced by the pancreas, is activated. Trypsin cuts peptide chains mainly at the carboxyl side of the amino acids lysine or arginine. It is used for numerous biotechnological processes. The process is commonly referred to as trypsin proteolysis or trypsinization, and proteins that have been digested/treated with trypsin are said to have been trypsinized.[4] Trypsin was discovered in 1876 by Wilhelm Kühne and was named from the Ancient Greek word for rubbing since it was first isolated by rubbing the pancreas with glycerin

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396