SJ. Rocks @SaraJaneRocks
04 October, 08:11

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396
memes matter @NoComment
04 October, 08:53
In response SJ. Rocks to her Publication

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396
The Mac @TheMac
04 October, 08:59
In response memes matter to her Publication
EGFP Sequence (717bp without STOP CODON):
5'-
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAA GTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGC TGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAG CAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTA CAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG ACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAAC GGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACAC CCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACG AGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG +STOP CODON-3'

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396
memes matter @NoComment
04 October, 09:02
In response The Mac to his Publication
What is the GFP nucleotide sequence?

Green fluorescent protein.

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396
The Mac @TheMac
04 October, 09:09
In response memes matter to her Publication
👍🏻

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396
The Mac @TheMac
04 October, 09:18
In response The Mac to his Publication

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396
The Mac @TheMac
04 October, 09:21
In response The Mac to his Publication
Inhibitors of cathepsin L prevent severe acute respiratory syndrome coronavirus entry
Graham Simmons*†, Dhaval N. Gosalia‡, Andrew J. Rennekamp*, Jacqueline D. Reeves*, Scott L. Diamond‡§, and Paul Bates*†
*Department of Microbiology, School of Medicine and Departments of ‡Bioengineering and §Chemical and Biomolecular Engineering, Institute for Medicine and Engineering, University of Pennsylvania, Philadelphia, PA 19104
Communicated by Harold E. Varmus, Memorial Sloan–Kettering Cancer Center, New York, NY, July 1, 2005 (received for review May 5, 2005)

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396
The Mac @TheMac
04 October, 09:22
In response The Mac to his Publication

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396
The Mac @TheMac
04 October, 09:37
In response The Mac to his Publication

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396
The Mac @TheMac
04 October, 09:52
In response The Mac to his Publication
Trypsin (EC 3.4.21.4) is a serine protease from the PA clan superfamily, found in the digestive system of many vertebrates, where it hydrolyzes proteins.[2][3] Trypsin is formed in the small intestine when its proenzyme form, the trypsinogen produced by the pancreas, is activated. Trypsin cuts peptide chains mainly at the carboxyl side of the amino acids lysine or arginine. It is used for numerous biotechnological processes. The process is commonly referred to as trypsin proteolysis or trypsinization, and proteins that have been digested/treated with trypsin are said to have been trypsinized.[4] Trypsin was discovered in 1876 by Wilhelm Kühne and was named from the Ancient Greek word for rubbing since it was first isolated by rubbing the pancreas with glycerin

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396
The Mac @TheMac
Cathepsin L
Cathepsin L released from the lysosome into the newly formed autophagolysosomes degrades any trypsinogen which may be present and prevents its activation to trypsin, hence short-circuiting any inappropriate activation of other zymogen pro-enzymes.
From: Haschek and Rousseaux's Handbook of Toxicologic Pathology (Third Edition), 2013
09:53 PM - Oct 04, 2021
In response The Mac to his Publication
Only people mentioned by TheMac in this post can reply
The Mac @TheMac
04 October, 09:59
In response The Mac to his Publication
CatL is probably involved in processing SARS-CoV-2 spike protein. As its inhibition is detrimental to SARS-CoV-2 infection and possibly exit from cells during late stages of infection, CatL could have been considered a valuable therapeutic target. Therefore, we describe here some drugs already in the market with potential CatL inhibiting capacity that could be used to treat COVID-19 patients.

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396
memes matter @NoComment
05 October, 03:51
In response The Mac to his Publication
The jabbed have aids. Or is it HIV? Aids are a parasite like all "cancer"
Easy to get rid of, concealed in fear over there not being a cure like Ivermectin is said to be, like a healthy ph value will be,the cure i mean. Many ways to alkaline our bodies, applecidervinegar is one.

Notice: Undefined index: tg1tga_access in /home/admin/www/anonup.com/themes/default/apps/timeline/post.phtml on line 396